Click here to enlarge.
PDB ID: 8qkx
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34863
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Agustin, D.; Vianney, Y.; Weisz, K.; Wahjudi, M.. "Structural Aspects of Split G-Quadruplexes in Quadruplex-Duplex Hybrid Systems" .
Assembly members:
entity_1, polymer, 24 residues, 7498.800 Da.
entity_2, polymer, 14 residues, 4366.836 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CTCCAGCTGGGTGAGGGGCT
GGGT
entity_2: TTGGAGCTGGAGTT
Data type | Count |
13C chemical shifts | 42 |
1H chemical shifts | 261 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
2 | unit_2 | 2 |
Entity 1, unit_1 24 residues - 7498.800 Da.
1 | DC | DT | DC | DC | DA | DG | DC | DT | DG | DG | ||||
2 | DG | DT | DG | DA | DG | DG | DG | DG | DC | DT | ||||
3 | DG | DG | DG | DT |
Entity 2, unit_2 14 residues - 4366.836 Da.
1 | DT | DT | DG | DG | DA | DG | DC | DT | DG | DG | ||||
2 | DA | DG | DT | DT |