BMRB Entry 34876
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34876
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Jagannath, J.; Vianney, Y.; Weisz, K.. "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes" Chem. Commun. (Camb) 60, 854-857 (2024).
PubMed: 38131370
Assembly members:
entity_1, polymer, 27 residues, 8501.428 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GCGTGGGTCAGGGTTGGGTT
GGGACGC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 29 |
| 1H chemical shifts | 178 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 27 residues - 8501.428 Da.
| 1 | DG | DC | DG | DT | DG | DG | DG | DT | DC | DA | ||||
| 2 | DG | DG | DG | DT | DT | DG | DG | DG | DT | DT | ||||
| 3 | DG | DG | DG | DA | DC | DG | DC |
Samples:
sample_1: DNA (27-MER) 0.3 mM; potassium phosphate buffer 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 303 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
Software:
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
TopSpin v4.0.7, Bruker Biospin - data analysis
NMR spectrometers:
- Bruker AVANCE NEO 600 MHz