Click here to enlarge.
PDB ID: 8r4w
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34877
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Jana, J.; Vianney, Y.; Weisz, K.. "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes" Chem. Commun. (Camb) 60, 854-857 (2024).
PubMed: 38131370
Assembly members:
entity_1, polymer, 25 residues, 7906.078 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTCAGGGTTGGGTTG
GGTAA
Data type | Count |
13C chemical shifts | 43 |
1H chemical shifts | 175 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 25 residues - 7906.078 Da.
1 | DT | DG | DA | DG | DG | DG | DT | DC | DA | DG | ||||
2 | DG | DG | DT | DT | DG | DG | DG | DT | DT | DG | ||||
3 | DG | DG | DT | DA | DA |