Click here to enlarge.
PDB ID: 8r6g
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34881
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Dierks, D.; Weisz, K.. "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions" Adv. Sci. (Weinh) ., e2309891-e2309891 (2024).
PubMed: 38477454
Assembly members:
entity_1, polymer, 33 residues, 10468.545 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCGCGAAGCATTCGCGGG
GTTAGGGTTXGXG
Data type | Count |
13C chemical shifts | 36 |
1H chemical shifts | 219 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 33 residues - 10468.545 Da.
1 | DG | DG | DG | DC | DG | DC | DG | DA | DA | DG | ||||
2 | DC | DA | DT | DT | DC | DG | DC | DG | DG | DG | ||||
3 | DG | DT | DT | DA | DG | DG | DG | DT | DT | A1H3G | ||||
4 | DG | BGM | DG |