Click here to enlarge.
PDB ID: 8rzx
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34898
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Jana, J.; Weisz, K.. "Solution structure of a parallel stranded G-quadruplex formed in ORAI1 promoter" .
Assembly members:
entity_1, polymer, 24 residues, 7613.863 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGGGCGGGGCACAGGTGGGC
GGGG
Data type | Count |
13C chemical shifts | 37 |
1H chemical shifts | 136 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 24 residues - 7613.863 Da.
1 | DT | DG | DG | DG | DC | DG | DG | DG | DG | DC | ||||
2 | DA | DC | DA | DG | DG | DT | DG | DG | DG | DC | ||||
3 | DG | DG | DG | DG |