BMRB Entry 36168
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36168
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence PubMed: 29666187
Deposition date: 2018-02-28 Original release date: 2019-01-09
Authors: Liu, Y.; Lan, W.
Citation: Liu, Yaping; Lan, Wenxian; Wang, Chunxi; Cao, Chunyang. "A putative G-quadruplex structure in the proximal promoter of VEGFR-2 has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem. 293, 8947-8955 (2018).
Assembly members:
entity_1, polymer, 24 residues, 7563.837 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTACCCGGGTGAGGTGCG
GGGT
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 11 |
| 1H chemical shifts | 236 |
| 31P chemical shifts | 24 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 24 residues - 7563.837 Da.
| 1 | DG | DG | DG | DT | DA | DC | DC | DC | DG | DG | ||||
| 2 | DG | DT | DG | DA | DG | DG | DT | DG | DC | DG | ||||
| 3 | DG | DG | DG | DT |
Samples:
sample_1: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3') 1 mM; potassium chloride 80 mM; potassium phosphate 20 mM; H2O 90%; D2O, [U-2H], 10%
sample_2: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3') 1.0 mM; potassium chloride 80 mM; potassium phosphate 20 mM; D2O, [U-2H], 100%
sample_3: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3'), [U-13C; U-15N]-Gua, 0.1 mM; potassium chloride 80 mM; potassium phosphate 20 mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 100 mM; pH: 6.8; pressure: 1 atm; temperature: 293 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_1 |
Software:
CNS, Brunger A.T. et.al. - refinement
NMR spectrometers:
- Varian INOVA 600 MHz
- Varian INOVA 800 MHz
- Bruker Avance 600 MHz