BMRB Entry 4253
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4253
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Holland, Jason; Hansen, Mark; Du, Zhiua; Hoffman, Dave. "An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the
Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2" RNA 5, 257-271 (1999).
Assembly members:
Gene 32 mRNA Pseudoknot of Bacteriophage T2, polymer, 36 residues, Formula weight is not available
Natural source: Common Name: Bacteriophage T2 Taxonomy ID: 10664 Superkingdom: not available Kingdom: not available Genus/species: T4-like phages coliphage T2
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Gene 32 mRNA Pseudoknot of Bacteriophage T2: GCUGACCAGCUAUGAGGUCA
UACAUCGUCAUAGCAC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 162 |
| 15N chemical shifts | 93 |
| 1H chemical shifts | 221 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | T2 RNA Pseudoknot | 1 |
Entities:
Entity 1, T2 RNA Pseudoknot 36 residues - Formula weight is not available
| 1 | G | C | U | G | A | C | C | A | G | C | ||||
| 2 | U | A | U | G | A | G | G | U | C | A | ||||
| 3 | U | A | C | A | U | C | G | U | C | A | ||||
| 4 | U | A | G | C | A | C |