Click here to enlarge.
PDB ID: 1b4y
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4400
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.. "Structure and Mechanism of Formation of the H-y5 isomer of an intramolecular DNA
triple helix" Nat. Struct. Biol. 6, 854-859 (1999).
Assembly members:
H-y5 Triple Helix, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemically_synthesized
Entity Sequences (FASTA):
H-y5 Triple Helix: TCTTCCTTTTCCTTCTCCCG
AGAAGGTTTT
Data type | Count |
1H chemical shifts | 247 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | h-y5 | 1 |
Entity 1, h-y5 30 residues - Formula weight is not available
1 | DT | DC | DT | DT | DC | DC | DT | DT | DT | DT | |
2 | DC | DC | DT | DT | DC | DT | DC | DC | DC | DG | |
3 | DA | DG | DA | DA | DG | DG | DT | DT | DT | DT |