Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4750
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Schmitz, U.; James, T.; Lukavsky, P.; Walter, P.. "Structure of the Most Conserved internal loop in Srp RNA" Nat. Struct. Biol. 6, 634-638 (1999).
Assembly members:
SRP DOMAIN IV, polymer, 28 residues, 8000 Da.
Natural source: Common Name: Escherichia coli Taxonomy ID: 562 Superkingdom: Eubacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
SRP DOMAIN IV: GGCGUCAGGUCCGGAAGGAA
GCAGCGCC
Data type | Count |
1H chemical shifts | 214 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | SRP DOMAIN IV | 1 |
Entity 1, SRP DOMAIN IV 28 residues - 8000 Da.
1 | G | G | C | G | U | C | A | G | G | U | ||||
2 | C | C | G | G | A | A | G | G | A | A | ||||
3 | G | C | A | G | C | G | C | C |