Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50047
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Yanjiao; Han, Ge; Jiang, Xiuying; Yuwen, Tairan; Xue, Yi. "Chemical shift prediction of RNA imino groups: application toward characterizing RNA excited states" Nat. Commun. 12, 1595-1595 (2021).
PubMed: 33707433
Assembly members:
hairpin RNA HP027, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: in vitro transcription
Entity Sequences (FASTA):
hairpin RNA HP027: GGGUGGUUCCGUCUUCGGAC
GGAACCGUCC
Data type | Count |
15N chemical shifts | 16 |
1H chemical shifts | 16 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HP027 | 1 |
Entity 1, HP027 30 residues - Formula weight is not available
1 | G | G | G | U | G | G | U | U | C | C | |
2 | G | U | C | U | U | C | G | G | A | C | |
3 | G | G | A | A | C | C | G | U | C | C |