BMRB Entry 50095
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50095
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications PubMed: 32239363
Deposition date: 2019-11-28 Original release date: 2020-09-19
Authors: Catala, Marjorie; Gato, Alexandre; Tisne, Carine; Barraud, Pierre
Citation: Catala, Marjorie; Gato, Alexandre; Tisne, Carine; Barraud, Pierre. "1H, 15N chemical shift assignments of the imino groups of yeast tRNA Phe: influence of the post-transcriptional modifications" Biomol. NMR Assignments 14, 169-174 (2020).
Assembly members:
unmodified yeast tRNAPhe, polymer, 76 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
unmodified yeast tRNAPhe: GCGGAUUUAGCUCAGUUGGG
AGAGCGCCAGACUGAAGAUC
UGGAGGUCCUGUGUUCGAUC
CACAGAAUUCGCACCA
- assigned_chemical_shifts
Data type | Count |
15N chemical shifts | 27 |
1H chemical shifts | 27 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | tRNAPhe | 1 |
Entities:
Entity 1, tRNAPhe 76 residues - Formula weight is not available
1 | G | C | G | G | A | U | U | U | A | G | ||||
2 | C | U | C | A | G | U | U | G | G | G | ||||
3 | A | G | A | G | C | G | C | C | A | G | ||||
4 | A | C | U | G | A | A | G | A | U | C | ||||
5 | U | G | G | A | G | G | U | C | C | U | ||||
6 | G | U | G | U | U | C | G | A | U | C | ||||
7 | C | A | C | A | G | A | A | U | U | C | ||||
8 | G | C | A | C | C | A |
Samples:
sample_1: entity_1 1.8-2.0 mM; sodium phosphate 10 mM; magnesium chloride 10 mM
sample_2: entity_1, [U-15N]-Gua, [U-15N]-Ura, 1.5-1.8 mM; sodium phosphate 10 mM; magnesium chloride 10 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 311 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N BEST-TROSY | sample_2 | isotropic | sample_conditions_1 |
3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
Software:
TOPSPIN v3.5, Bruker Biospin - collection, processing
SPARKY, Goddard - chemical shift assignment, data analysis
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker Avance 700 MHz
Related Database Links:
tRNADB | tdbR00000083 |