Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50095
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Catala, Marjorie; Gato, Alexandre; Tisne, Carine; Barraud, Pierre. "1H, 15N chemical shift assignments of the imino groups of yeast tRNA Phe: influence of the post-transcriptional modifications" Biomol. NMR Assignments 14, 169-174 (2020).
PubMed: 32239363
Assembly members:
unmodified yeast tRNAPhe, polymer, 76 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
unmodified yeast tRNAPhe: GCGGAUUUAGCUCAGUUGGG
AGAGCGCCAGACUGAAGAUC
UGGAGGUCCUGUGUUCGAUC
CACAGAAUUCGCACCA
Data type | Count |
15N chemical shifts | 27 |
1H chemical shifts | 27 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | tRNAPhe | 1 |
Entity 1, tRNAPhe 76 residues - Formula weight is not available
1 | G | C | G | G | A | U | U | U | A | G | ||||
2 | C | U | C | A | G | U | U | G | G | G | ||||
3 | A | G | A | G | C | G | C | C | A | G | ||||
4 | A | C | U | G | A | A | G | A | U | C | ||||
5 | U | G | G | A | G | G | U | C | C | U | ||||
6 | G | U | G | U | U | C | G | A | U | C | ||||
7 | C | A | C | A | G | A | A | U | U | C | ||||
8 | G | C | A | C | C | A |
tRNADB | tdbR00000083 |