Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50237
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Nishikawa, Tadateru; Wojciak, Jonathan; Dyson, Helen Jane; Wright, Peter. "RNA Binding by the KTS Splice Variants of Wilms' Tumor Suppressor Protein WT1" Biochemistry 59, 3889-3901 (2020).
PubMed: 32955251
Assembly members:
entity_1, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCCACCAACGACAUUGAU
AUGGUGCCC
Data type | Count |
13C chemical shifts | 179 |
15N chemical shifts | 6 |
1H chemical shifts | 211 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA | 1 |
Entity 1, RNA 29 residues - Formula weight is not available
1 | G | G | G | C | C | A | C | C | A | A | ||||
2 | C | G | A | C | A | U | U | G | A | U | ||||
3 | A | U | G | G | U | G | C | C | C |