BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50237

Title: free aptamer RNA   PubMed: 32955251

Deposition date: 2020-04-14 Original release date: 2021-03-01

Authors: Nishikawa, Tadateru; Wojciak, Jonathan; Dyson, Helen Jane; Wright, Peter

Citation: Nishikawa, Tadateru; Wojciak, Jonathan; Dyson, Helen Jane; Wright, Peter. "RNA Binding by the KTS Splice Variants of Wilms' Tumor Suppressor Protein WT1"  Biochemistry 59, 3889-3901 (2020).

Assembly members:
entity_1, polymer, 29 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
entity_1: GGGCCACCAACGACAUUGAU AUGGUGCCC

Data sets:
Data typeCount
13C chemical shifts179
15N chemical shifts6
1H chemical shifts211

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1

Entities:

Entity 1, RNA 29 residues - Formula weight is not available

1   GGGCCACCAA
2   CGACAUUGAU
3   AUGGUGCCC

Samples:

sample_1: aptamer RNA, [U-99% 13C; U-99% 15N], 0.55 ± 0.1 mM; TRIS, [U-100% 2H], 10 ± 0.1 mM; potassium chloride 350 ± 0.5 mM; DTT 10 ± 0.1 mM; ZnSO4 5 ± 0.1 uM; sodium azide 2 ± 0.1 mM

sample_2: aptamer RNA, [U-100% 15N], 0.55 ± 0.1 mM; TRIS, [U-100% 2H], 10 ± 0.1 mM; potassium chloride 350 ± 0.5 mM; DTT 10 ± 0.1 mM; ZnSO4 5 ± 0.1 uM; sodium azide 2 ± 0.1 mM

sample_conditions_1: ionic strength: 350 mM; pH: 7.1; pressure: 1 atm; temperature: 310 K

sample_conditions_2: ionic strength: 350 mM; pH: 7.1; pressure: 1 atm; temperature: 280 K

Experiments:

NameSampleSample stateSample conditions
3D HCCH-COSYsample_1isotropicsample_conditions_1
3D HMQC-NOESYsample_1isotropicsample_conditions_1

Software:

NMRPipe - processing

NMRView - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 750 MHz
  • Bruker Avance 500 MHz
  • Bruker DRX 800 MHz
  • Bruker DRX 600 MHz