Click here to enlarge.
PDB ID: 6xb7
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50268
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Davila-Calderon, Jesse; Patwardhan, Neeraj; Chiu, Liang-Yuan; Sugarman, Andrew; Cai, Zhengguo; Penutmutchu, Srinivasa; Li, Mei-Ling; Brewer, Gary; Hargrove, Amanda; Tolbert, Blanton. "IRES-targeting small molecule inhibits enterovirus 71 replication via allosteric stabilization of a ternary complex" Nat. Commun. 11, 4775-4775 (2020).
PubMed: 32963221
Assembly members:
entity_1, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Enterovirus A71 Taxonomy ID: 138948 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Enterovirus A71
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAUCAAUAGCAGGUGUGGC
ACACCAGUCAUACCUUGAUC
C
Data type | Count |
1H chemical shifts | 119 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | EV71 RNA(41-MER) | 1 |
Entity 1, EV71 RNA(41-MER) 41 residues - Formula weight is not available
1 | G | G | A | U | C | A | A | U | A | G | ||||
2 | C | A | G | G | U | G | U | G | G | C | ||||
3 | A | C | A | C | C | A | G | U | C | A | ||||
4 | U | A | C | C | U | U | G | A | U | C | ||||
5 | C |