BMRB Entry 50344
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50344
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Assignment of base 1H and 15N chemical shifts for 5_SL2+3 PubMed: 33167030
Deposition date: 2020-06-23 Original release date: 2020-07-10
Authors: Schwalbe, Harald; Richter, Christian
Citation: Wacker, Anna; Weigand, Julia; Akabayov, Sabine; Altincekic, Nadide; Kaur Bains, Jasleen; Banijamali, Elnaz; Binas, Oliver; Castillo-Martinez, Jesus; Cetiner, Erhan; Ceylan, Betul; Chiu, Liang-Yuan; Davila-Calderon, Jesse; De Jesus, Vanessa; Dhamotharan, Karthikeyan; Duchardt-Ferner, Elke; Ferner, Jan; Frydman, Lucio; Furtig, Boris; Gallego, Jose; Grun, J. Tassilo; Hacker, Carolin; Haddad, Christina; Hahnke, Martin; Hengesbach, Martin; Hiller, Fabian; Hohmann, Katharina; Hymon, Daniel; Jonker, Henry; Keller, Heiko; Knezic, Bozana; Landgraf, Tom; Lohr, Frank; Luo, Luke; Mertinkus, Klara; Muhs, Christina; Novakovic, Mihajlo; Oxenfarth, Andreas; Palomino-Schatzlein, Martina; Petzold, Katja; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Riad, Magdalena; Richter, Christian; Saxena, Krishna; Schamber, Tatjana; Scherf, Tali; Schlagnitweit, Judith; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Simba-Lahuasi, Alvaro; Sreeramulu, Sridhar; Stirnal, Elke; Sudakov, Alexey; Tants, Jan-Niklas; Tolbert, Blanton; Vogele, Jenny; Weiss, Lena; Wirmer-Bartoschek, Julia; Wirtz Martin, Maria; Wohnert, Jens; Zetzsche, Heidi. "Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy" Nucleic Acids Res. 48, 12415-12435 (2020).
Assembly members:
entity_1, polymer, 32 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: transcription Host organism: in-vitro
Entity Sequences (FASTA):
entity_1: GGAUCUCUUGUAGAUCUGUU
CUCUAAACGAAC
- assigned_chemical_shifts
Data type | Count |
15N chemical shifts | 43 |
1H chemical shifts | 52 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | 5_SL2+3 | 1 |
Entities:
Entity 1, 5_SL2+3 32 residues - Formula weight is not available
1 | G | G | A | U | C | U | C | U | U | G | ||||
2 | U | A | G | A | U | C | U | G | U | U | ||||
3 | C | U | C | U | A | A | A | C | G | A | ||||
4 | A | C |
Samples:
sample_1: 5_SL2+3, 15N, 405 uM; potassium phosphate 25 mM; KCl 50 mM
sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
NOESY-JR[15N]-Amino | sample_1 | isotropic | sample_conditions_1 |
HSQC[15N] | sample_1 | isotropic | sample_conditions_1 |
NOESY[15N]CPMG | sample_1 | isotropic | sample_conditions_1 |
NOESY-JR[15N]-Amino | sample_1 | isotropic | sample_conditions_1 |
HSQC[15N]-2J | sample_1 | isotropic | sample_conditions_1 |
1H-JR[15N] | sample_1 | isotropic | sample_conditions_1 |
TROSY[15N] | sample_1 | isotropic | sample_conditions_1 |
HSQC[15N] | sample_1 | isotropic | sample_conditions_1 |
HNN-COSY[15N] | sample_1 | isotropic | sample_conditions_1 |
Software:
LOGS v2.2 - collection
SPARKY v3.114 - chemical shift assignment, peak picking
TOPSPIN v3.6.2 - collection
NMR spectrometers:
- Bruker Bruker Avance III 800 MHz 800 MHz