Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50570
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Soni, Komal; Kempf, Georg; Manalastas-Cantos, Karen; Hendricks, Astrid; Flemming, Dirk; Guizetti, Julien; Simon, Bernd; Frischknecht, Friedrich; Svergun, Dmitri; Wild, Klemens; Sinning, Irmgard. "Structural analysis of the SRP Alu domain from Plasmodium falciparum reveals a non-canonical open conformation" Commun. Biol. 4, 600-600 (2021).
PubMed: 34017052
Assembly members:
entity_1, polymer, 30 residues, 9700 Da.
Natural source: Common Name: Plasmodium falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCUACUGUUCUUUUUAAGU
UCAGUAGCUC
Data type | Count |
1H chemical shifts | 15 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Helix3 | 1 |
Entity 1, Helix3 30 residues - 9700 Da.
1 | G | G | C | U | A | C | U | G | U | U | |
2 | C | U | U | U | U | U | A | A | G | U | |
3 | U | C | A | G | U | A | G | C | U | C |