BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50661

Title: 5_SL8   PubMed: 34161644

Deposition date: 2020-12-20 Original release date: 2022-02-01

Authors: Schwalbe, Harald; Sreeramulu, Sridhar; Richter, Christian

Citation: Sreeramulu, Sridhar; Richter, Christian; Berg, Hannes; Wirtz Martin, Maria; Ceylan, Betul; Matzel, Tobias; Adam, Jennifer; Altincekic, Nadide; Azzaoui, Kamal; Bains, Jasleen Kaur; Blommers, Marcel; Ferner, Jan; Furtig, Boris; Gobel, M.; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Martins, Jason; Mertinkus, Klara; Niesteruk, Anna; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Scheffer, Ute; Schlundt, Andreas; Schnieders, Robbin; Stirnal, Elke; Sudakov, Alexey; Troster, Alix; Vogele, Jennifer; Wacker, Anna; Weigand, Julia; Wirmer-Bartoschek, Julia; Wohnert, Jens; Schwalbe, Harald. "Exploring the druggability of conserved RNA regulatory elements in the SARS-CoV-2 genome"  Angew. Chem. Int. Ed. Engl. 60, 19191-19200 (2021).

Assembly members:
entity_1, polymer, 63 residues, Formula weight is not available
entity_2, non-polymer, Formula weight is not available

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:   Production method: transcription   Host organism: in-vitro

Entity Sequences (FASTA):
entity_1: GGACUUGUGGCUUAGUAGAA GUUGAAAAAGGCGUUUUGCC UCAACUUGAACAGCCCUAUG UCC

Data sets:
Data typeCount

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_SL81
2DSI-Poised Library (DSI-PL)2

Entities:

Entity 1, 5_SL8 63 residues - Formula weight is not available

1   GGACUUGUGG
2   CUUAGUAGAA
3   GUUGAAAAAG
4   GCGUUUUGCC
5   UCAACUUGAA
6   CAGCCCUAUG
7   UCC

Entity 2, DSI-Poised Library (DSI-PL) - Formula weight is not available

Samples:

sample_1: 5_SL8 10 uM; potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM

sample_2: potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
1D 1Hsample_1isotropicsample_conditions_1
1D 1H waterLOGSYsample_1isotropicsample_conditions_1
1H R2 CPMG 5mssample_1isotropicsample_conditions_1
1H R2 CPMG 100mssample_1isotropicsample_conditions_1
1D 1H refsample_2isotropicsample_conditions_1
1D 1H waterLOGSY refsample_2isotropicsample_conditions_1
1H R2 CPMG 5ms refsample_2isotropicsample_conditions_1
1H R2 CPMG 100ms refsample_2isotropicsample_conditions_1

Software:

LOGS v2.2 - collection

TOPSPIN v4.0.9 - collection, data analysis

NMR spectrometers:

  • Bruker Bruker Avance III 600 MHz