Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50667
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sreeramulu, Sridhar; Richter, Christian; Berg, Hannes; Wirtz Martin, Maria; Ceylan, Betul; Matzel, Tobias; Adam, Jennifer; Altincekic, Nadide; Azzaoui, Kamal; Bains, Jasleen Kaur; Blommers, Marcel; Ferner, Jan; Furtig, Boris; Gobel, M.; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Martins, Jason; Mertinkus, Klara; Niesteruk, Anna; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Scheffer, Ute; Schlundt, Andreas; Schnieders, Robbin; Stirnal, Elke; Sudakov, Alexey; Troster, Alix; Vogele, Jennifer; Wacker, Anna; Weigand, Julia; Wirmer-Bartoschek, Julia; Wohnert, Jens; Schwalbe, Harald. "Exploring the druggability of conserved RNA regulatory elements in the SARS-CoV-2 genome" Angew. Chem. Int. Ed. Engl. 60, 19191-19200 (2021).
PubMed: 34161644
Assembly members:
entity_1, polymer, 32 residues, Formula weight is not available
entity_2, non-polymer, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: transcription Host organism: in-vitro
Entity Sequences (FASTA):
entity_1: GGCAUGCUUCAGUCAGCUGA
UGCACAAUCGUU
Data type | Count |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | att HP | 1 |
2 | DSI-Poised Library (DSI-PL) | 2 |
Entity 1, att HP 32 residues - Formula weight is not available
1 | G | G | C | A | U | G | C | U | U | C | ||||
2 | A | G | U | C | A | G | C | U | G | A | ||||
3 | U | G | C | A | C | A | A | U | C | G | ||||
4 | U | U |
Entity 2, DSI-Poised Library (DSI-PL) - Formula weight is not available