BMRB Entry 50924
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50924
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RNA89 PubMed: 34449019
Deposition date: 2021-05-05 Original release date: 2021-05-24
Authors: Liu, Yaping; Keane, Sarah
Citation: Liu, Yaping; Kotar, Anita; Hodges, Tracy; Abdallah, Kyrillos; Taleb, Mallak; Bitterman, Brayden; Jaime, Sara; Schaubroeck, Kyle; Mathew, Ethan; Morgenstern, Nick; Lohmeier, Anthony; Page, Jordan; Ratanapanichkich, Matt; Arhin, Grace; Johnson, Breanna; Cherepanov, Stanislav; Moss, Stephen; Zuniga, Gisselle; Tilson, Nicholas; Yeoh, Zoe; Johnson, Bruce; Keane, Sarah. "NMR chemical shift assignments of RNA oligonucleotides to expand the RNA chemical shift database" Biomol. NMR Assign. 15, 479-490 (2021).
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: in vitro
Entity Sequences (FASTA):
entity_1: GGGUUGGCUGAGAAGCCAAC
CC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 27 |
1H chemical shifts | 117 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA89 | 1 |
Entities:
Entity 1, RNA89 22 residues - Formula weight is not available
1 | G | G | G | U | U | G | G | C | U | G | ||||
2 | A | G | A | A | G | C | C | A | A | C | ||||
3 | C | C |
Samples:
sample_1: RNA89 400 uM; potassium phosphate 50 mM
sample_conditions_1: ionic strength: 0.05 M; pH: 7.4; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HMQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN v4.0.9 - collection
NMRFx Analyst - processing
NMRPipe - processing
NMRViewJ - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE NEO 600 MHz