BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50925

Title: RNA75   PubMed: 34449019

Deposition date: 2021-05-05 Original release date: 2021-05-24

Authors: Liu, Yaping; Keane, Sarah

Citation: Liu, Yaping; Kotar, Anita; Hodges, Tracy; Abdallah, Kyrillos; Taleb, Mallak; Bitterman, Brayden; Jaime, Sara; Schaubroeck, Kyle; Mathew, Ethan; Morgenstern, Nick; Lohmeier, Anthony; Page, Jordan; Ratanapanichkich, Matt; Arhin, Grace; Johnson, Breanna; Cherepanov, Stanislav; Moss, Stephen; Zuniga, Gisselle; Tilson, Nicholas; Yeoh, Zoe; Johnson, Bruce; Keane, Sarah. "NMR chemical shift assignments of RNA oligonucleotides to expand the RNA chemical shift database"  Biomol. NMR Assign. 15, 479-490 (2021).

Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: In vitro transcription   Host organism: in vitro

Entity Sequences (FASTA):
entity_1: GGCUAGGCUGAGAAGCCUAG CC

Data sets:
Data typeCount
13C chemical shifts27
1H chemical shifts111

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA751

Entities:

Entity 1, RNA75 22 residues - Formula weight is not available

1   GGCUAGGCUG
2   AGAAGCCUAG
3   CC

Samples:

sample_1: RNA75 400 uM; potassium phosphate 50 mM

sample_conditions_1: ionic strength: 0.05 M; pH: 7.4; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HMQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1

Software:

TOPSPIN v4.0.9 - collection

NMRFx Analyst - processing

NMRPipe - processing

NMRViewJ - chemical shift assignment

NMR spectrometers:

  • Bruker AVANCE NEO 600 MHz