BMRB Entry 51127
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51127
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: A functional SNP regulates E-cadherin expression by dynamically remodeling the 3D structure of a promoter-associated non-coding RNA transcript PubMed: 36243981
Deposition date: 2021-10-05 Original release date: 2022-10-05
Authors: Sharma, Shrikant; Varani, Gabriele
Citation: Sharma, Shrikant; Pisignano, Giuseppina; Merulla, Jessica; Catapano, Carlo; Varani, Gabriele. "A functional SNP regulates E-cadherin expression by dynamically remodeling the 3D structure of a promoter-associated non-coding RNA transcript" Nucleic Acids Res. 50, 11331-11343 (2022).
Assembly members:
entity_1, polymer, 94 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic synthesis by invitro transcription Host organism: T7 RNA polymerase
Entity Sequences (FASTA):
entity_1: GGACCCAUAACCCACCUAGA
CCCUAGCUUCGGCUAGAGGG
UCAACGCGAAAGCGAGGCCG
GGUGGGCGGGUACGUCCGCC
CUGGGGAGGGGUCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 530 |
15N chemical shifts | 29 |
1H chemical shifts | 654 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | paRNA | 1 |
Entities:
Entity 1, paRNA 94 residues - Formula weight is not available
1 | G | G | A | C | C | C | A | U | A | A | ||||
2 | C | C | C | A | C | C | U | A | G | A | ||||
3 | C | C | C | U | A | G | C | U | U | C | ||||
4 | G | G | C | U | A | G | A | G | G | G | ||||
5 | U | C | A | A | C | G | C | G | A | A | ||||
6 | A | G | C | G | A | G | G | C | C | G | ||||
7 | G | G | U | G | G | G | C | G | G | G | ||||
8 | U | A | C | G | U | C | C | G | C | C | ||||
9 | C | U | G | G | G | G | A | G | G | G | ||||
10 | G | U | C | C |
Samples:
sample_1: paRNA, [U-99% 13C; U-99% 15N], 0.75 mM; paRNA, [U-99% 13C; U-99% 15N], 0.75 mM; Sodium phosphate 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1D 1H | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
NMRFAM-SPARKY - chemical shift assignment
NMR spectrometers:
- Bruker Avance 600 and 800 MHz MHz