Click here to enlarge.
PDB ID: 7shx
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51127
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sharma, Shrikant; Pisignano, Giuseppina; Merulla, Jessica; Catapano, Carlo; Varani, Gabriele. "A functional SNP regulates E-cadherin expression by dynamically remodeling the 3D structure of a promoter-associated non-coding RNA transcript" Nucleic Acids Res. 50, 11331-11343 (2022).
PubMed: 36243981
Assembly members:
entity_1, polymer, 94 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic synthesis by invitro transcription Host organism: T7 RNA polymerase
Entity Sequences (FASTA):
entity_1: GGACCCAUAACCCACCUAGA
CCCUAGCUUCGGCUAGAGGG
UCAACGCGAAAGCGAGGCCG
GGUGGGCGGGUACGUCCGCC
CUGGGGAGGGGUCC
Data type | Count |
13C chemical shifts | 530 |
15N chemical shifts | 29 |
1H chemical shifts | 654 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | paRNA | 1 |
Entity 1, paRNA 94 residues - Formula weight is not available
1 | G | G | A | C | C | C | A | U | A | A | ||||
2 | C | C | C | A | C | C | U | A | G | A | ||||
3 | C | C | C | U | A | G | C | U | U | C | ||||
4 | G | G | C | U | A | G | A | G | G | G | ||||
5 | U | C | A | A | C | G | C | G | A | A | ||||
6 | A | G | C | G | A | G | G | C | C | G | ||||
7 | G | G | U | G | G | G | C | G | G | G | ||||
8 | U | A | C | G | U | C | C | G | C | C | ||||
9 | C | U | G | G | G | G | A | G | G | G | ||||
10 | G | U | C | C |