BMRB Entry 51134
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51134
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kotar, Anita; Ma, Sicong; Keane, Sarah. "pH dependence of C*A, G*A and A*A mismatches in the stem of precursor microRNA-31" Biophys. Chem. 283, 106763-106763 (2022).
PubMed: 35114594
Assembly members:
entity_1, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: in vitro enzymatic synthesis
Entity Sequences (FASTA):
entity_1: GGCAAGAUGCUGGGAGACCA
ACAUAUUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 38 |
| 1H chemical shifts | 141 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA | 1 |
Entities:
Entity 1, RNA 30 residues - Formula weight is not available
| 1 | G | G | C | A | A | G | A | U | G | C | |
| 2 | U | G | G | G | A | G | A | C | C | A | |
| 3 | A | C | A | U | A | U | U | G | C | C |