Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51164
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: de Jesus, Vanessa; Biedenbander, Thomas; Vogele, Jennifer; Wohnert, Jens; Furtig, Boris. "NMR assignment of non-modified tRNA Ile from Escherichia coli" Biomol. NMR Assign. 16, 165-170 (2022).
PubMed: 35275364
Assembly members:
entity_1, polymer, 77 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: AGGCUUGUAGCUCAGGUGGU
UAGAGCGCACCCCUGAUAAG
GGUGAGGUCGGUGGUUCAAG
UCCACUCAGGCCUACCA
Data type | Count |
13C chemical shifts | 11 |
15N chemical shifts | 74 |
1H chemical shifts | 61 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | tRNAIle | 1 |
Entity 1, tRNAIle 77 residues - Formula weight is not available
1 | A | G | G | C | U | U | G | U | A | G | ||||
2 | C | U | C | A | G | G | U | G | G | U | ||||
3 | U | A | G | A | G | C | G | C | A | C | ||||
4 | C | C | C | U | G | A | U | A | A | G | ||||
5 | G | G | U | G | A | G | G | U | C | G | ||||
6 | G | U | G | G | U | U | C | A | A | G | ||||
7 | U | C | C | A | C | U | C | A | G | G | ||||
8 | C | C | U | A | C | C | A |