BMRB Entry 51164
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51164
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Assignment of tRNAIle from Escherichia coli PubMed: 35275364
Deposition date: 2021-11-01 Original release date: 2022-01-23
Authors: de Jesus, Vanessa; Biedenbander, Thomas; Vogele, Jennifer; Wohnert, Jens; Furtig, Boris
Citation: de Jesus, Vanessa; Biedenbander, Thomas; Vogele, Jennifer; Wohnert, Jens; Furtig, Boris. "NMR assignment of non-modified tRNA Ile from Escherichia coli" Biomol. NMR Assign. 16, 165-170 (2022).
Assembly members:
entity_1, polymer, 77 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: AGGCUUGUAGCUCAGGUGGU
UAGAGCGCACCCCUGAUAAG
GGUGAGGUCGGUGGUUCAAG
UCCACUCAGGCCUACCA
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 11 |
15N chemical shifts | 74 |
1H chemical shifts | 61 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | tRNAIle | 1 |
Entities:
Entity 1, tRNAIle 77 residues - Formula weight is not available
1 | A | G | G | C | U | U | G | U | A | G | ||||
2 | C | U | C | A | G | G | U | G | G | U | ||||
3 | U | A | G | A | G | C | G | C | A | C | ||||
4 | C | C | C | U | G | A | U | A | A | G | ||||
5 | G | G | U | G | A | G | G | U | C | G | ||||
6 | G | U | G | G | U | U | C | A | A | G | ||||
7 | U | C | C | A | C | U | C | A | G | G | ||||
8 | C | C | U | A | C | C | A |
Samples:
sample_1: tRNAIle, [U-100% 13C; U-100% 15N], 800 mM; D2O, [U-2H], 7%; DSS 250 mM; potassium chloride 200 mM; potassium phosphate 25 mM; magnesium chloride 5 mM
sample_conditions_1: ionic strength: 230 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K
sample_conditions_3: ionic strength: 230 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H,15N HNN-COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H,15N BEST-TROSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H,1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H,1H NOESY | sample_1 | isotropic | sample_conditions_3 |
2D 1H,15N CPMG NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H,15N 2J SOFAST HMQC | sample_1 | isotropic | sample_conditions_1 |
13C-detected 2D (H)CN-HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC NH2 only | sample_1 | isotropic | sample_conditions_1 |
2D 1H,1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
NMRFAM-SPARKY v1.47 - chemical shift assignment
TOPSPIN v3.5 - processing
NMR spectrometers:
- Bruker AVANCE IIIHD 600 MHz
- Bruker AVANCE IIIHD 700 MHz
- Bruker AVANCE III 800 MHz
- Bruker AVANCE IIIHD 800 MHz
- Bruker AVANCE NEO 900 MHz
- Bruker AVANCE NEO 950 MHz