BMRB Entry 51348
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51348
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Yaping; Munsayac, Aldrex; Hall, Ian; Keane, Sarah. "Solution structure of NPSL2, a regulatory element in the oncomiR-1 RNA" J. Mol. Biol. ., .-..
Assembly members:
entity_1, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGGUGUAGAAGAGAUUCUAC
ACCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 31 |
| 1H chemical shifts | 221 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | NPSL2_Frag1 | 1 |
Entities:
Entity 1, NPSL2_Frag1 24 residues - Formula weight is not available
| 1 | G | G | G | U | G | U | A | G | A | A | ||||
| 2 | G | A | G | A | U | U | C | U | A | C | ||||
| 3 | A | C | C | C |