BMRB Entry 51697
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51697
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ma, Sicong; Kotar, Anita; Hall, Ian; Grote, Scott; Rouskin, Silvi; Keane, Sarah. "Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing" Proc. Natl. Acad. Sci. U. S. A. 120, e2300527120-e2300527120 (2023).
PubMed: 37725636
Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCAUAGCUACGGCUAUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 23 |
| 1H chemical shifts | 90 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | pre-miRNA fragment | 1 |
Entities:
Entity 1, pre-miRNA fragment 20 residues - Formula weight is not available
| 1 | G | G | C | A | U | A | G | C | U | A | |
| 2 | C | G | G | C | U | A | U | G | C | C |