BMRB Entry 51809
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51809
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Yaqiang; He, Yao; Wang, Yanjiao; Yang, Yuan; Singh, Mahavir; Eichhom, Catherine; Cheng, Xinyi; Jiang, Yi Xiao; Zhou, Z.Hong; Feigon, Juli. "Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR" J. Mol. Biol. 435, 168044-168044 (2023).
PubMed: 37330293
Assembly members:
entity_1, polymer, 21 residues, Formula weight is not available
Natural source: Common Name: Tetrahymena Thermophilia Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: Tetrahymena Thermophilia
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: AUACCCGCUUCGGCGGGACA
A
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 9 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | stem 1 hairpin with linker of Tetrahymena telomerase RNA | 1 |
Entities:
Entity 1, stem 1 hairpin with linker of Tetrahymena telomerase RNA 21 residues - Formula weight is not available
| 1 | A | U | A | C | C | C | G | C | U | U | ||||
| 2 | C | G | G | C | G | G | G | A | C | A | ||||
| 3 | A |