BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 51809

Title: Stem 1 hairpin with linker of Tytrahymena telomerase RNA   PubMed: 37330293

Deposition date: 2023-01-25 Original release date: 2023-06-19

Authors: Wang, Yaqiang; Feigon, Juli

Citation: Wang, Yaqiang; He, Yao; Wang, Yanjiao; Yang, Yuan; Singh, Mahavir; Eichhom, Catherine; Cheng, Xinyi; Jiang, Yi Xiao; Zhou, Z.Hong; Feigon, Juli. "Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR"  J. Mol. Biol. 435, 168044-168044 (2023).

Assembly members:
entity_1, polymer, 21 residues, Formula weight is not available

Natural source:   Common Name: Tetrahymena Thermophilia   Taxonomy ID: 5911   Superkingdom: Eukaryota   Kingdom: not available   Genus/species: Tetrahymena Thermophilia

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
entity_1: AUACCCGCUUCGGCGGGACA A

Data sets:
Data typeCount
1H chemical shifts9

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1stem 1 hairpin with linker of Tetrahymena telomerase RNA1

Entities:

Entity 1, stem 1 hairpin with linker of Tetrahymena telomerase RNA 21 residues - Formula weight is not available

1   AUACCCGCUU
2   CGGCGGGACA
3   A

Samples:

sample_1: stem 1 hairpin of Tetrahymena telomerase RNA with ACAA linker 0.05 mM; D2O, [U-100% 2H], 10%; sodium phosphate 10 mM; potassium chloride 50 mM; H2O 90%

sample_conditions_1: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
1D 1Hsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

TOPSPIN - collection

NMRFAM-SPARKY - chemical shift assignment

NMRDraw - processing

NMRPipe - processing

NMR spectrometers:

  • Bruker AVANCE III 800 MHz