BMRB Entry 51809
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51809
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Stem 1 hairpin with linker of Tytrahymena telomerase RNA PubMed: 37330293
Deposition date: 2023-01-25 Original release date: 2023-06-19
Authors: Wang, Yaqiang; Feigon, Juli
Citation: Wang, Yaqiang; He, Yao; Wang, Yanjiao; Yang, Yuan; Singh, Mahavir; Eichhom, Catherine; Cheng, Xinyi; Jiang, Yi Xiao; Zhou, Z.Hong; Feigon, Juli. "Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR" J. Mol. Biol. 435, 168044-168044 (2023).
Assembly members:
entity_1, polymer, 21 residues, Formula weight is not available
Natural source: Common Name: Tetrahymena Thermophilia Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: Tetrahymena Thermophilia
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: AUACCCGCUUCGGCGGGACA
A
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 9 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | stem 1 hairpin with linker of Tetrahymena telomerase RNA | 1 |
Entities:
Entity 1, stem 1 hairpin with linker of Tetrahymena telomerase RNA 21 residues - Formula weight is not available
1 | A | U | A | C | C | C | G | C | U | U | ||||
2 | C | G | G | C | G | G | G | A | C | A | ||||
3 | A |
Samples:
sample_1: stem 1 hairpin of Tetrahymena telomerase RNA with ACAA linker 0.05 mM; D2O, [U-100% 2H], 10%; sodium phosphate 10 mM; potassium chloride 50 mM; H2O 90%
sample_conditions_1: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1D 1H | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN - collection
NMRFAM-SPARKY - chemical shift assignment
NMRDraw - processing
NMRPipe - processing
NMR spectrometers:
- Bruker AVANCE III 800 MHz