BMRB Entry 51869
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51869
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ruckriegel, Stefanie; Hohmann, Katharina; Furtig, Boris. "A Protonated Cytidine Stabilizes the Ligand-Binding Pocket in the PreQ1 Riboswitch in Thermophilic Bacteria" Chembiochem 24, e202300228-e202300228 (2023).
PubMed: 37314020
Assembly members:
entity_1, polymer, 33 residues, Formula weight is not available
entity_PRF, non-polymer, 179.179 Da.
Natural source: Common Name: Caldanaerobacter subterraneus subsp. tengcongensis Taxonomy ID: 911092 Superkingdom: Bacteria Kingdom: not available Genus/species: Caldanaerobacter subterraneus
Experimental source: Production method: in vitro transcription Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: CUGGGUCGCAGUAACCCCAG
UUAACAAAACAAG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 296 |
| 15N chemical shifts | 121 |
| 1H chemical shifts | 293 |
| 31P chemical shifts | 31 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | riboswitch | 1 |
| 2 | ligand | 2 |
Entities:
Entity 1, riboswitch 33 residues - Formula weight is not available
| 1 | C | U | G | G | G | U | C | G | C | A | ||||
| 2 | G | U | A | A | C | C | C | C | A | G | ||||
| 3 | U | U | A | A | C | A | A | A | A | C | ||||
| 4 | A | A | G |
Entity 2, ligand - C7 H9 N5 O - 179.179 Da.
| 1 | PRF |