BMRB Entry 51869
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51869
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Resonance assignment of the preQ1 riboswitch from Thermotoga tengcongensis PubMed: 37314020
Deposition date: 2023-03-06 Original release date: 2023-04-06
Authors: Ruckriegel, Stefanie; Hohmann, Katharina
Citation: Ruckriegel, Stefanie; Hohmann, Katharina; Furtig, Boris. "A Protonated Cytidine Stabilizes the Ligand-Binding Pocket in the PreQ1 Riboswitch in Thermophilic Bacteria" Chembiochem 24, e202300228-e202300228 (2023).
Assembly members:
entity_1, polymer, 33 residues, Formula weight is not available
entity_PRF, non-polymer, 179.179 Da.
Natural source: Common Name: Caldanaerobacter subterraneus subsp. tengcongensis Taxonomy ID: 911092 Superkingdom: Bacteria Kingdom: not available Genus/species: Caldanaerobacter subterraneus
Experimental source: Production method: in vitro transcription Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: CUGGGUCGCAGUAACCCCAG
UUAACAAAACAAG
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 296 |
15N chemical shifts | 121 |
1H chemical shifts | 293 |
31P chemical shifts | 31 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | riboswitch | 1 |
2 | ligand | 2 |
Entities:
Entity 1, riboswitch 33 residues - Formula weight is not available
1 | C | U | G | G | G | U | C | G | C | A | ||||
2 | G | U | A | A | C | C | C | C | A | G | ||||
3 | U | U | A | A | C | A | A | A | A | C | ||||
4 | A | A | G |
Entity 2, ligand - C7 H9 N5 O - 179.179 Da.
1 | PRF |
Samples:
sample_1: preQ1 riboswitch, [U-99% 13C; U-99% 15N], 805 uM; PRF 1127 uM; D2O, [U-99% 2H], 10%
sample_conditions_1: ionic strength: 518 mM; pH: 6.2; pressure: 1 atm; temperature: 313 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC/HMQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
3D HCCH-COSY | sample_1 | isotropic | sample_conditions_1 |
3D HNN COSY | sample_1 | isotropic | sample_conditions_1 |
3D HCP TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D CC-TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D HDQC | sample_1 | isotropic | sample_conditions_1 |
Software:
SPARKY - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE III 800 MHz