BMRB Entry 51905
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51905
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: StASL domain of EMCV IRES J-K-St. PubMed: 37640715
Deposition date: 2023-04-13 Original release date: 2023-08-09
Authors: Imai, Shunsuke; Shimada, Ichio
Citation: Imai, Shunsuke; Suzuki, Hiroshi; Fujiyoshi, Yoshinori; Shimada, Ichio. "Dynamically regulated two-site interaction of viral RNA to capture host translation initiation factor" Nat. Commun. 14, 4977-4977 (2023).
Assembly members:
entity_1, polymer, 63 residues, Formula weight is not available
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus Cardiovirus A
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCUGAAGGAUGCCCAGCU
UCGGCUGGGGCCUCGUUCGC
GAGGUUAAAAAACGUCUAGG
CCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 34 |
1H chemical shifts | 34 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | StASL | 1 |
Entities:
Entity 1, StASL 63 residues - Formula weight is not available
1 | G | G | G | C | U | G | A | A | G | G | ||||
2 | A | U | G | C | C | C | A | G | C | U | ||||
3 | U | C | G | G | C | U | G | G | G | G | ||||
4 | C | C | U | C | G | U | U | C | G | C | ||||
5 | G | A | G | G | U | U | A | A | A | A | ||||
6 | A | A | C | G | U | C | U | A | G | G | ||||
7 | C | C | C |
Samples:
sample_1: StASL domain, [U-2H, {13C8,1H2,1H8}-A, {13C8,1H8}-G], 1 mM; D2O 100%; potassium phosphate 10 mM; sodium chloride 10 mM
sample_conditions_1: ionic strength: 0.02 M; pH: 6.4; pressure: 1 atm; temperature: 303 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C TROSY aromatic | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN - chemical shift assignment, peak picking, processing
NMR spectrometers:
- Bruker Ascend Evo 1.0GHz 1000 MHz