Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51906
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Imai, Shunsuke; Suzuki, Hiroshi; Fujiyoshi, Yoshinori; Shimada, Ichio. "Dynamically regulated two-site interaction of viral RNA to capture host translation initiation factor" Nat. Commun. 14, 4977-4977 (2023).
PubMed: 37640715
Assembly members:
entity_1, polymer, 39 residues, Formula weight is not available
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus Cardiovirus A
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCAGAAGGUACCCCAUUG
UAUGGGAUCUGAUCUGCCC
Data type | Count |
13C chemical shifts | 18 |
1H chemical shifts | 18 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Jdomain | 1 |
Entity 1, Jdomain 39 residues - Formula weight is not available
1 | G | G | G | C | A | G | A | A | G | G | ||||
2 | U | A | C | C | C | C | A | U | U | G | ||||
3 | U | A | U | G | G | G | A | U | C | U | ||||
4 | G | A | U | C | U | G | C | C | C |