BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 52053

Title: Residual dipolar couplings measured on HIV-1 TAR ES1 mutant A35G using Pf1 phage alignment media for validating FARFAR-NMR ensemble   PubMed: 37831584

Deposition date: 2023-07-22 Original release date: 2023-07-26

Authors: Roy, Rohit; Geng, Ainan; Shi, Honglue; Merriman, Dawn; Dethoff, Elizabeth; Salmon, Loic; Al-Hashimi, Hashim

Citation: Roy, Rohit; Geng, Ainan; Shi, Honglue; Merriman, Dawn; Dethoff, Elizabeth; Salmon, Loic; Al-Hashimi, Hashim. "Kinetic Resolution of the Atomic 3D Structures Formed by Ground and Excited Conformational States in an RNA Dynamic Ensemble"  J. Am. Chem. Soc. 145, 22964-22978 (2023).

Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGCGAGCCUGGGGGCUCGCC

Data sets:
Data typeCount
residual dipolar couplings15

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1A35G_monomer1

Entities:

Entity 1, A35G_monomer 20 residues - Formula weight is not available

1   GGCGAGCCUG
2   GGGGCUCGCC

Samples:

sample_1: A35G HIV-1 TAR RNA EII3 mutant 2 mM; D2O 10%; EDTA 0.1 mM; sodium chloride 25 mM; sodium phosphate 15 mM

sample_conditions_1: pH: 6.4; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 13C-1H S3CT HSQCsample_1isotropicsample_conditions_1
2D 13C-1H TROSY HSQCsample_1isotropicsample_conditions_1
2D 13C-1H S3CT HSQCsample_1anisotropicsample_conditions_1
2D 13C-1H TROSY HSQCsample_1anisotropicsample_conditions_1

Software:

NMRPipe - data analysis

NMR spectrometers:

  • Bruker AVANCE III 800 MHz