BMRB Entry 52092
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52092
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution NMR chemical shift assignments for a subdomain construct of 7SK SL3 RNA in the SL3a state PubMed: 37609139
Deposition date: 2023-08-22 Original release date: 2023-09-11
Authors: Eichhorn, Catherine
Citation: Camara, Momodou; Lange, Bret; Yesselman, Joseph; Eichhorn, Catherine. "Visualizing a two-state conformational ensemble in stem-loop 3 of the transcriptional regulator 7SK RNA" Nucleic Acids Res. ., .-. (2023).
Assembly members:
entity_1, polymer, 38 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCUCCAAACAAGCUCUCAA
GGUCCAUUUGUAGGAGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 78 |
15N chemical shifts | 12 |
1H chemical shifts | 118 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | SL3a-top hairpin | 1 |
Entities:
Entity 1, SL3a-top hairpin 38 residues - Formula weight is not available
1 | G | G | C | U | C | C | A | A | A | C | ||||
2 | A | A | G | C | U | C | U | C | A | A | ||||
3 | G | G | U | C | C | A | U | U | U | G | ||||
4 | U | A | G | G | A | G | C | C |
Samples:
sample_1: SL3a-top hairpin 0.8 mM; SL3a-top hairpin, [U-100% 13C; U-100% 15N], 0.8 mM; Sodium Phosphate 20 mM; Potassium Chloride 50 mM
sample_conditions_1: ionic strength: 50 mM; pH: 6.0; pressure: 1 atm; temperature: 298.15 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
Software:
NMRFAM-SPARKY - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE NEO 600 MHz