Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52092
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Camara, Momodou; Lange, Bret; Yesselman, Joseph; Eichhorn, Catherine. "Visualizing a two-state conformational ensemble in stem-loop 3 of the transcriptional regulator 7SK RNA" Nucleic Acids Res. ., .-. (2023).
PubMed: 37609139
Assembly members:
entity_1, polymer, 38 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCUCCAAACAAGCUCUCAA
GGUCCAUUUGUAGGAGCC
Data type | Count |
13C chemical shifts | 78 |
15N chemical shifts | 12 |
1H chemical shifts | 118 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | SL3a-top hairpin | 1 |
Entity 1, SL3a-top hairpin 38 residues - Formula weight is not available
1 | G | G | C | U | C | C | A | A | A | C | ||||
2 | A | A | G | C | U | C | U | C | A | A | ||||
3 | G | G | U | C | C | A | U | U | U | G | ||||
4 | U | A | G | G | A | G | C | C |