BMRB Entry 52285
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52285
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Yaping; Harkner, Cade; Westwood, Megan; Munsayac, Aldrex; Keane, Sarah. "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing" J. Mol. Biol. ., .-. (2025).
PubMed: 40609633
Assembly members:
entity_1, polymer, 73 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGUAGCACUAAAGUGCUUAU
AGUGCAGGUAGUGUUUAGUU
AUCUACUGCAUUAUGAGCAC
UUAAAGUACUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 81 |
| 15N chemical shifts | 33 |
| 1H chemical shifts | 348 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | pre-miR-20a | 1 |
Entities:
Entity 1, pre-miR-20a 73 residues - Formula weight is not available
| 1 | G | G | U | A | G | C | A | C | U | A | ||||
| 2 | A | A | G | U | G | C | U | U | A | U | ||||
| 3 | A | G | U | G | C | A | G | G | U | A | ||||
| 4 | G | U | G | U | U | U | A | G | U | U | ||||
| 5 | A | U | C | U | A | C | U | G | C | A | ||||
| 6 | U | U | A | U | G | A | G | C | A | C | ||||
| 7 | U | U | A | A | A | G | U | A | C | U | ||||
| 8 | G | C | C |