Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52424
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Hernandez-Marin, Maria; Cantero-Camacho, Angel; Mena, Ignacio; Lopez-Nunez, Sergio; Garcia-Sastre, Adolfo; Gallego, Jose. "Sarbecovirus programmed ribosome frameshift RNA element folding studied by NMR spectroscopy and comparative analyses" Nucleic Acids Res 52, 11960-11972 (2024).
PubMed: 39149904
Assembly members:
entity_1, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: in vitro transcription Host organism: Not applicable
Entity Sequences (FASTA):
entity_1: GGUGCUUCAGUCAGCUGAUG
CACC
Data type | Count |
15N chemical shifts | 22 |
1H chemical shifts | 24 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Attenuator hairpin of SARS-CoV-2 PRF | 1 |
Entity 1, Attenuator hairpin of SARS-CoV-2 PRF 24 residues - Formula weight is not available
The sequences experimentally analyzed in this study correspond to SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI NC_045512). To obtain genomic numbering add 13,419 to the author's sequence numbers.
1 | G | G | U | G | C | U | U | C | A | G | ||||
2 | U | C | A | G | C | U | G | A | U | G | ||||
3 | C | A | C | C |