Click here to enlarge.
PDB ID: 1ir5
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5243
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, W.; Vu, H.; Kearns, D.. "1H NMR Study of a 17-mer DNA Duplex" Biochim. Biophys. Acta 1574, 93-99 (2002).
PubMed: 11955617
Assembly members:
17mer TF1 Binding Site, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: Bacillus subtilis Taxonomy ID: 1423 Superkingdom: Eubacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
17mer TF1 Binding Site: CACTACTCTTTGTAGTGCAC
TACAAAGAGTAGTG
Data type | Count |
1H chemical shifts | 363 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | 17mer TF1 Binding Site | 1 |
Entity 1, 17mer TF1 Binding Site 34 residues - Formula weight is not available
1 | DC | DA | DC | DT | DA | DC | DT | DC | DT | DT | ||||
2 | DT | DG | DT | DA | DG | DT | DG | DC | DA | DC | ||||
3 | DT | DA | DC | DA | DA | DA | DG | DA | DG | DT | ||||
4 | DA | DG | DT | DG |