Click here to enlarge.
PDB ID: 1l1w
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5321
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.. "Solution Structure of a SRP19 Binding Domain in Human SRP RNA" J. Biochem. (Tokyo) 132, 177-182 (2002).
PubMed: 12153712
Assembly members:
helix 6 of signal recognition particle RNA, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
helix 6 of signal recognition particle RNA: GGUGACCUCCCGGGAGCGGG
GGACCACCA
Data type | Count |
1H chemical shifts | 164 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | helix 6 of SRP RNA | 1 |
Entity 1, helix 6 of SRP RNA 29 residues - Formula weight is not available
1 | G | G | U | G | A | C | C | U | C | C | ||||
2 | C | G | G | G | A | G | C | G | G | G | ||||
3 | G | G | A | C | C | A | C | C | A |