BMRB Entry 5559
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5559
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Partial 1H and 13C assignments for 3'-stem-loop of human U4 small nuclear RNA
Deposition date: 2002-10-15 Original release date: 2002-12-27
Authors: Comolli, L.; Ulyanov, N.; James, T.; Gmeiner, W.
Citation: Comolli, L.; Ulyanov, N.; Soto, A.; Marky, L.; James, T.; Gmeiner, W.. "NMR Structure of the 3' Stem-Loop from Human U4 snRNA" Nucleic Acids Res. 30, 4371-4379 (2002).
Assembly members:
single chain of RNA, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
single chain of RNA: GACAGUCUCUACGGAGACUG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 67 |
| 1H chemical shifts | 117 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 3'SL of U4 snRNA | 1 |
Entities:
Entity 1, 3'SL of U4 snRNA 20 residues - Formula weight is not available
| 1 | G | A | C | A | G | U | C | U | C | U | |
| 2 | A | C | G | G | A | G | A | C | U | G |
Samples:
sample_1: single chain of RNA 1 mM; sodium phosphate 10 mM; NaCl 50 mM
sample_cond_1: ionic strength: 60 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K
sample_cond_2: ionic strength: 60 mM; pH: 6.4; pressure: 1 atm; temperature: 293 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| 2D SS-NOESY | not available | not available | not available |
| 2D DQF-COSY | not available | not available | not available |
| 2D TOCSY | not available | not available | not available |
| natural abundance 13C-HMQC | not available | not available | not available |
Software:
VNMR v6.1 - collection
NMRPipe v2.1 - processing
SPARKY v3.0 - data analysis
MARDIGRAS v3.2 - iterative matrix relaxation
DYANA v1.5 - refinement
miniCarlo vn/a - refinement
NMR spectrometers:
- Varian INOVA 600 MHz