Click here to enlarge.
PDB ID: 1na2
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5632
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.. "Mutations Linked to Dyskeratosis congenita Cause Changes in the Structural
Equilibrium in Telomerase RNA" Proc. Natl. Acad. Sci. U. S. A. 100, 449-454 (2003).
PubMed: 12525685
Assembly members:
human telomerase RNA, polymer, 30 residues, 9900 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
human telomerase RNA: GGGCUGUUUUUCUCGCUGAC
UUUCAGCCCC
Data type | Count |
13C chemical shifts | 201 |
15N chemical shifts | 25 |
1H chemical shifts | 262 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | telomerase RNA p2b hairpin | 1 |
Entity 1, telomerase RNA p2b hairpin 30 residues - 9900 Da.
1 | G | G | G | C | U | G | U | U | U | U | |
2 | U | C | U | C | G | C | U | G | A | C | |
3 | U | U | U | C | A | G | C | C | C | C |