BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5834

Title: Solution structure of the HIV-1 frameshift inducing stem-loop RNA   PubMed: 12888491

Deposition date: 2003-06-17 Original release date: 2003-09-12

Authors: Staple, David; Butcher, Samuel

Citation: Staple, David; Butcher, Samuel. "Solution Structure of the HIV-1 Frameshift Inducing Stem-loop RNA"  Nucleic Acids Res. 31, 4326-4331 (2003).

Assembly members:
HIV-1 frameshift inducing stem-loop RNA, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: HIV   Taxonomy ID: 12721   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
HIV-1 frameshift inducing stem-loop RNA: GGCCUUCCCACAAGGGAAGG CC

Data sets:
Data typeCount
13C chemical shifts59
15N chemical shifts31
1H chemical shifts155

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1HIV-1 frameshift inducing stem-loop RNA1

Entities:

Entity 1, HIV-1 frameshift inducing stem-loop RNA 22 residues - Formula weight is not available

1   GGCCUUCCCA
2   CAAGGGAAGG
3   CC

Samples:

Sample_1: HIV-1 frameshift inducing stem-loop RNA 1.0 mM

condition_1: pH: 6.8; temperature: 303 K

condition_2: pH: 6.8; temperature: 283 K

condition_3: pH: 6.8; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H-1H NOESYnot availablenot availablenot available
1H-1H TOCSYnot availablenot availablenot available
1H-13C HSQCnot availablenot availablenot available
HCCH-TOCSYnot availablenot availablenot available
HCCH-COSYnot availablenot availablenot available
HNN-COSYnot availablenot availablenot available
1H-13C-1H NOESY HMQCnot availablenot availablenot available

Software:

No software information available

NMR spectrometers:

  • Bruker DMX 750 MHz
  • Bruker DMX 600 MHz