BMRB Entry 5919
Click here to enlarge.
PDB ID: 1mnx
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5919
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vallurupalli, Pramodh; Moore, Peter. "The solution structure of the loop E region of the 5S rRNA from spinach
chloroplasts" J. Mol. Biol. 325, 843-856 (2003).
PubMed: 12527295
Assembly members:
Loop E of 5S rRNA from spinach chloroplasts, polymer, 42 residues, 14468 Da.
Natural source: Common Name: Spinach Taxonomy ID: 3562 Superkingdom: Eukaryota Kingdom: Viridiplantae Genus/species: Spinacia oleracea
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Loop E of 5S rRNA from spinach chloroplasts: GGGUGACGAUACUGUAGGCG
AGAGCCUGCGGAAAAAUAGC
CC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 110 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 253 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Loop E of 5S rRNA from spinach chloroplasts | 1 |
Entities:
Entity 1, Loop E of 5S rRNA from spinach chloroplasts 42 residues - 14468 Da.
| 1 | G | G | G | U | G | A | C | G | A | U | ||||
| 2 | A | C | U | G | U | A | G | G | C | G | ||||
| 3 | A | G | A | G | C | C | U | G | C | G | ||||
| 4 | G | A | A | A | A | A | U | A | G | C | ||||
| 5 | C | C |