BMRB Entry 6042
Click here to enlarge.
PDB ID: 1rfr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6042
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA
and its Interaction with the Proteinase 3C" Stucture 12, 237-248 (2004).
PubMed: 14962384
Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: COXSACKIEVIRUS B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA
CCUUUGUGUC
- coupling_constants
| Data type | Count |
| coupling constants | 14 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | SLD-RNA | 1 |
Entities:
Entity 1, SLD-RNA 30 residues - Formula weight is not available
| 1 | G | G | C | A | C | U | C | U | G | G | |
| 2 | U | A | U | C | A | C | G | G | U | A | |
| 3 | C | C | U | U | U | G | U | G | U | C |