BMRB Entry 6042

Title:
NMR structure of the 30mer stemloop-D of coxsackieviral RNA
Deposition date:
2003-12-11
Original release date:
2004-11-30
Authors:
Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.
Citation:

Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA and its Interaction with the Proteinase 3C"  Stucture 12, 237-248 (2004).
PubMed: 14962384

Assembly members:

Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: COXSACKIEVIRUS B3   Taxonomy ID: 12072   Superkingdom: Viruses   Kingdom: not available   Genus/species: Enterovirus Human enterovirus B

Experimental source:

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):

Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA CCUUUGUGUC

Data sets:
  • coupling_constants
Data typeCount
coupling constants14

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SLD-RNA1

Entities:

Entity 1, SLD-RNA 30 residues - Formula weight is not available

1   GGCACUCUGG
2   UAUCACGGUA
3   CCUUUGUGUC

Samples:

sample_1: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_2: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_3: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_4: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_5: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_6: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_7: SLD-RNA, [U-15N], 1.4 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%

sample_8: SLD-RNA, [U-15N], 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%

sample_cond_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_cond_2: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
not availablenot availablenot availablenot available

Software:

VNMR v6.1, rev. c - collection, processing

XEASY v1.3.9 - data analysis

FOUND vimplemented in CYANA-1.0.6 - structure solution

CYANA v1.0.6 - structure solution

OPAL v2.6 - refinement

NMR spectrometers:

  • Varian INOVA 750 MHz