BMRB Entry 6094
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6094
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus PubMed: 15003457
Deposition date: 2004-02-06 Original release date: 2004-05-15
Authors: DSouza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael
Citation: D'Souza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael. "NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus" J. Mol. Biol. 337, 427-442 (2004).
Assembly members:
single chain of RNA, polymer, 101 residues, Formula weight is not available
Natural source: Common Name: Moloney Murine Leukemia Virus Taxonomy ID: 11786 Superkingdom: Viruses Kingdom: not available Genus/species: Gammaretrovirus murine leukemia virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
single chain of RNA: GGCGGUACUAGUUGAGAAAC
UAGCUCUGUAUCUGGUGGAC
CCGUGGUGGAACUGUGAAGU
UCGGAACACCCGGCCGCAAC
CCUGGGAGAGGUCCCAGGGU
U
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 578 |
15N chemical shifts | 35 |
1H chemical shifts | 683 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | psi site monomer | 1 |
Entities:
Entity 1, psi site monomer 101 residues - Formula weight is not available
1 | G | G | C | G | G | U | A | C | U | A | ||||
2 | G | U | U | G | A | G | A | A | A | C | ||||
3 | U | A | G | C | U | C | U | G | U | A | ||||
4 | U | C | U | G | G | U | G | G | A | C | ||||
5 | C | C | G | U | G | G | U | G | G | A | ||||
6 | A | C | U | G | U | G | A | A | G | U | ||||
7 | U | C | G | G | A | A | C | A | C | C | ||||
8 | C | G | G | C | C | G | C | A | A | C | ||||
9 | C | C | U | G | G | G | A | G | A | G | ||||
10 | G | U | C | C | C | A | G | G | G | U | ||||
11 | U |
Samples:
sample_1: single chain of RNA, [13C; 15N]-Ade, 1.2
sample_2: single chain of RNA, [13C; 15N]-Gua, 1.2
sample_3: single chain of RNA, [13C; 15N]-Cyt, 1.2
sample_4: single chain of RNA, [13C; 15N]-Ura, 1.2
sample_5: single chain of RNA, [15N]-Gua-Ura, 1.2
sample_6: single chain of RNA, [2D]-Ade-Ura-Cyt, 1.2
sample_7: single chain of RNA, [2D]-Ade-Gua-Ura, 1.2
sample_8: single chain of RNA, [2D]-Ade-Gua-Cyt, 1.2
sample_9: single chain of RNA, [2D]-Gua-Cyt-Ura, 1.2
cond-1: pH: 7.0; temperature: 308 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | not available | not available | cond-1 |
2D ROESY | not available | not available | cond-1 |
2D HMQC | not available | not available | cond-1 |
3D HMQC-NOESY | not available | not available | cond-1 |
4d-HMQC NOESY HMQC | not available | not available | cond-1 |
2D 1H-15N HSQC | not available | not available | cond-1 |
3D HSQC-NOESY | not available | not available | cond-1 |
Software:
No software information available
NMR spectrometers:
- Bruker . 800 MHz
- Bruker . 600 MHz