BMRB Entry 6320
Click here to enlarge.
PDB ID: 1xhp
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6320
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sashital, Dipali; Cornilescu, Gabriel; McManus, C.; Brow, D.; Butcher, Samuel. "U2-U6 RNA folding reveals a group II intron-like domain and a four-helix
junction" Nat. Struct. Mol. Biol. 11, 1237-1242 (2004).
PubMed: 15543154
Assembly members:
U6 extended ISL, polymer, 32 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
U6 extended ISL: GAGCAGUUCCCCUGCAUAAG
GAUGAACCGUUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 189 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 272 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | U6 extended ISL | 1 |
Entities:
Entity 1, U6 extended ISL 32 residues - Formula weight is not available
| 1 | G | A | G | C | A | G | U | U | C | C | ||||
| 2 | C | C | U | G | C | A | U | A | A | G | ||||
| 3 | G | A | U | G | A | A | C | C | G | U | ||||
| 4 | U | C |