BMRB Entry 6485
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6485
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: A novel RNA pentaloop fold involved in targeting ADAR2 PubMed: 15840813
Deposition date: 2005-02-03 Original release date: 2005-05-26
Authors: Stefl, Richard; Allain, Frederic
Citation: Stefl, R.; Allain, F.. "A novel RNA pentaloop fold involved in targeting ADAR2" RNA 11, 592-597 (2005).
Assembly members:
GluR-B R/G stem-loop RNA, polymer, 27 residues, Formula weight is not available
Natural source: Common Name: 9606 Taxonomy ID: Human Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
GluR-B R/G stem-loop RNA: GGUAACAAUAUGCUAAAUGU
UGUUACC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 183 |
1H chemical shifts | 221 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | GluR-B R/G RNA | 1 |
Entities:
Entity 1, GluR-B R/G RNA 27 residues - Formula weight is not available
1 | G | G | U | A | A | C | A | A | U | A | ||||
2 | U | G | C | U | A | A | A | U | G | U | ||||
3 | U | G | U | U | A | C | C |
Samples:
sample_1: GluR-B R/G stem-loop RNA, [U-13C; U-15N], 0.5 2 mM
condition_1: pH: 6; temperature: 303 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | sample_1 | not available | condition_1 |
2D TOCSY | sample_1 | not available | condition_1 |
13C-HSQC | sample_1 | not available | condition_1 |
3D 13-separated NOESY | sample_1 | not available | condition_1 |
and 3D HCCH-TOCSY | sample_1 | not available | condition_1 |
Software:
No software information available
NMR spectrometers:
- Bruker Avance 900 MHz
- Bruker Avance 600 MHz