Click here to enlarge.
PDB ID: 1z2j
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6543
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Staple, David; Butcher, Samuel. "Soultion structure and thermodynamic investigation of the HIV-1 frameshift inducing element" J. Mol. Biol. 349, 1011-1023 (2005).
PubMed: 15927637
Assembly members:
HIV-1 frameshift induciting element RNA, polymer, 45 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: Not applicable Genus/species: HIV HIV
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
HIV-1 frameshift induciting element RNA: GGGAAGAUCUGGCCUUCCCA
CAAGGGAAGGCCAGGGAAUC
UUCCC
Data type | Count |
1H chemical shifts | 308 |
13C chemical shifts | 91 |
15N chemical shifts | 24 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HIV-1 frameshift inducing RNA | 1 |
Entity 1, HIV-1 frameshift inducing RNA 45 residues - Formula weight is not available
1 | G | G | G | A | A | G | A | U | C | U | ||||
2 | G | G | C | C | U | U | C | C | C | A | ||||
3 | C | A | A | G | G | G | A | A | G | G | ||||
4 | C | C | A | G | G | G | A | A | U | C | ||||
5 | U | U | C | C | C |