BMRB Entry 6756
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6756
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Erat, Michele; Zerbe, Oliver; Fox, Thomas; Sigel, Roland. "Solution Structure of Domain 6 from a Self-Splicing Group II Intron Ribozyme: A
Mg(2+) Binding Site is Located Close to the Stacked Branch Adenosine" Chembiochem. 8, 306-314 (2007).
PubMed: 17200997
Assembly members:
Domain 6, polymer, 27 residues, 8787 Da.
MG, non-polymer, 24.305 Da.
Natural source: Common Name: Saccharomyces cerevisiae Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Domain 6: GGAGCGGGGGUGUAAACCUA
UCGCUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 143 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 235 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | D6short | 1 |
| 2 | MAGNESIUM (II) ION | 2 |
Entities:
Entity 1, D6short 27 residues - 8787 Da.
| 1 | G | G | A | G | C | G | G | G | G | G | ||||
| 2 | U | G | U | A | A | A | C | C | U | A | ||||
| 3 | U | C | G | C | U | C | C |
Entity 2, MAGNESIUM (II) ION - Mg - 24.305 Da.
| 1 | MG |