BMRB Entry 7098
Click here to enlarge.
PDB ID: 2gm0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7098
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.. "NMR structure of the full-length linear dimer of stem-loop-1 RNA in the HIV-1
dimer initiation site" J. Biol. Chem. 281, 16168-16177 (2006).
PubMed: 16603544
Assembly members:
RNA (35-MER), polymer, 35 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA (35-MER): GACGGCUUGCUGAAGCGCGC
ACGGCAAGAGGCGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 137 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 181 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (35-MER), chain A | 1 |
| 2 | RNA (35-MER), chain B | 1 |
Entities:
Entity 1, RNA (35-MER), chain A 35 residues - Formula weight is not available
| 1 | G | A | C | G | G | C | U | U | G | C | ||||
| 2 | U | G | A | A | G | C | G | C | G | C | ||||
| 3 | A | C | G | G | C | A | A | G | A | G | ||||
| 4 | G | C | G | U | C |