BMRB Entry 30797
Click here to enlarge.
PDB ID: 7k4l
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30797
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sun, Y.. "Solution NMR Structure of Denv1 5'UTR SLA region" .
Assembly members:
entity_1, polymer, 36 residues, 11521.802 Da.
Natural source: Common Name: Escherichia phage T7 Taxonomy ID: 10760 Superkingdom: Viruses Kingdom: not available Genus/species: Teseptimavirus Escherichia virus T7
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGUGGUUAGUCUACGUUU
CGACGUAGUUCUAACC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 126 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 36 residues - 11521.802 Da.
| 1 | G | G | A | G | U | G | G | U | U | A | ||||
| 2 | G | U | C | U | A | C | G | U | U | U | ||||
| 3 | C | G | A | C | G | U | A | G | U | U | ||||
| 4 | C | U | A | A | C | C |