BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34529

Title: G-quadruplex with a G-A bulge   PubMed: 33096904

Deposition date: 2020-07-13 Original release date: 2021-05-21

Authors: Lenarcic Zivkovic, M.; Plavec, J.

Citation: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.. "Structure of a DNA G-Quadruplex Related to Osteoporosis with a G-A Bulge Forming a Pseudo-loop"  Molecules 25, 4867-4867 (2020).

Assembly members:
entity_1, polymer, 20 residues, 6401.113 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TGGGAGGGAGCGGGAGTGGG

Data sets:
Data typeCount
1H chemical shifts185

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 20 residues - 6401.113 Da.

1   DTDGDGDGDADGDGDGDADG
2   DCDGDGDGDADGDTDGDGDG

Samples:

sample_1: DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3') 0.6 mM

sample_2: DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3') 0.6 mM

sample_conditions_1: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H NOESYsample_2anisotropicsample_conditions_2
2D 1H-1H NOESYsample_2anisotropicsample_conditions_2
2D 1H-1H TOCSYsample_2anisotropicsample_conditions_2
2D DQF-COSYsample_2anisotropicsample_conditions_2

Software:

Sparky, Goddard - chemical shift assignment

Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

VNMR, Varian - processing

NMR spectrometers:

  • Agilent VNMRS 600 MHz
  • Agilent VNMRS 800 MHz