BMRB Entry 34631
Click here to enlarge.
PDB ID: 7oqt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34631
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marquevielle, J.; De Rache, A.; Vialet, B.; Morvan, E.; Mergny, J.; Amrane, S.. "G-quadruplex structure of the C. elegans telomeric repeat: a two tetrads basket type conformation stabilized by a non-canonical C-T base-pair" Nucleic Acids Res. 50, 7134-7146 (2022).
PubMed: 35736226
Assembly members:
entity_1, polymer, 20 residues, 6221.012 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: C. elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCTTAGGCTTAGGCTTAGG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 69 |
| 1H chemical shifts | 184 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entities:
Entity 1, unit_1 20 residues - 6221.012 Da.
| 1 | DG | DG | DC | DT | DT | DA | DG | DG | DC | DT | |
| 2 | DT | DA | DG | DG | DC | DT | DT | DA | DG | DG |
Entity 2, unit_2 - K - 39.098 Da.
| 1 | K |