Click here to enlarge.
PDB ID: 7q6l
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34676
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Z.; Jurt, S.; Dominguez-Martin, A.; Johannsen, S.; Sigel, R.. "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene" .
Assembly members:
entity_1, polymer, 22 residues, 7225.339 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCCAUAGGGUGGGAUCUG
GG
Data type | Count |
13C chemical shifts | 182 |
15N chemical shifts | 12 |
1H chemical shifts | 184 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 22 residues - 7225.339 Da.
1 | G | G | G | C | C | A | U | A | G | G | ||||
2 | G | U | G | G | G | A | U | C | U | G | ||||
3 | G | G |