BMRB Entry 34685
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34685
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a lanthanide-binding DNA aptamer PubMed: 36043489
Deposition date: 2021-11-18 Original release date: 2021-11-28
Authors: Andralojc, W.; Gdaniec, Z.
Citation: Andralojc, W.; Wieruszewska, J.; Pasternak, K.; Gdaniec, Z.. "Solution Structure of a Lanthanide-binding DNA Aptamer Determined Using High Quality pseudocontact shift restraints" Chemistry 28, e202202114-e202202114 (2022).
Assembly members:
entity_1, polymer, 28 residues, 8642.544 Da.
entity_LU, non-polymer, 174.967 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGGCCGTCGAAGACCCGCGA
AGTGGCCG
| Data type | Count |
| 1H chemical shifts | 779 |
| 31P chemical shifts | 79 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entities:
Entity 1, unit_1 28 residues - 8642.544 Da.
| 1 | DC | DG | DG | DC | DC | DG | DT | DC | DG | DA | ||||
| 2 | DA | DG | DA | DC | DC | DC | DG | DC | DG | DA | ||||
| 3 | DA | DG | DT | DG | DG | DC | DC | DG |
Entity 2, unit_2 - Lu - 174.967 Da.
| 1 | LU |
Samples:
sample_1: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Lutetium chloride 700 ± 35 uM
sample_2: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Europium chloride 700 ± 35 uM
sample_3: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Ytterbium acetate 700 ± 35 uM
sample_4: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; cerium chloride 700 ± 35 uM
sample_5: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; thulium chloride 700 ± 35 uM
sample_6: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Lutetium chloride 700 ± 35 uM
sample_conditions_1: ionic strength: 0.16 M; pH: 6.2; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 0.16 M; pH: 6.2; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | isotropic | not available |
| 2D 1H-13C HSQC | sample_1 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_1 | isotropic | not available |
| 2D 1H-31P COSY | sample_1 | isotropic | not available |
| 2D 1H-1H NOESY | sample_2 | isotropic | not available |
| 2D 1H-13C HSQC | sample_2 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_2 | isotropic | not available |
| 2D 1H-31P COSY | sample_2 | isotropic | not available |
| 2D NOESY | sample_3 | isotropic | not available |
| 2D 1H-13C HSQC | sample_3 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_3 | isotropic | not available |
| 2D 1H-31P COSY | sample_3 | isotropic | not available |
| 2D NOESY | sample_4 | isotropic | not available |
| 2D 1H-13C HSQC | sample_4 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_4 | isotropic | not available |
| 2D 1H-31P COSY | sample_4 | isotropic | not available |
| 2D NOESY | sample_5 | isotropic | not available |
| 2D 1H-13C HSQC | sample_5 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_5 | isotropic | not available |
| 2D 1H-31P COSY | sample_5 | isotropic | not available |
| 2D NOESY | sample_6 | isotropic | not available |
| 2D 1H-1H TOCSY | sample_6 | isotropic | not available |
Software:
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
NMRFAM-SPARKY, NMRFAM - chemical shift assignment, peak picking
NMR spectrometers:
- Bruker AVANCE III 700 MHz